dNTP

The reaction mixture contained 4 µg of total RNA, 20 pmol of oligo dT primer (Invitrogen Life Technologies), 40 U RNAsin, 1 M dNTP mix, and 1 U reverse transcriptase buffer.

PLoS ONE Alerts: New Articles Aline F. Oliveira et al. 2010

The final reaction mixture for each contained 100 ng of genomic DNA, 200 µM of each dNTP, 1.0 mM MgCl

PLoS ONE Alerts: New Articles Tomoji Mashimo et al. 2010

T4 DNA ligase buffer with 1 mM dATP (New England BioLabs [NEB]), 400 µM of each dNTP

PLoS ONE Alerts: New Articles Ceiridwen J. Edwards et al. 2010

Each pair of primers (10 µM) was used with 2 U Taq and 0.2 mM dNTP, and 1.5 mM MgCl2 in a 25-µL final volume.

PLoS ONE Alerts: New Articles Mariana M. Hecht et al. 2010

There has long been evidence supporting the idea that RNR and the dNTP-synthesizing complex must be closely linked to the replication complex or replisome.

BioMed Central - Latest articles M. Antonia Sanchez-Romero 2010

The reaction mixture contained 4 µg of total RNA, 20 pmol of oligo dT primer (Invitrogen Life Technologies), 40 U RNAsin, 1 M dNTP mix, and 1 U reverse transcriptase buffer.

PLoS ONE Alerts: New Articles 2010

Each pair of primers (10 µM) was used with 2 U Taq and 0.2 mM dNTP, and 1.5 mM MgCl2 in a 25-µL final volume.

PLoS ONE Alerts: New Articles Mariana M. Hecht et al. 2010

T7A18B primer (GCATTAGCGGCCGCGAAATTAATACGACTCACTATAGGGAG [A] 18B, where B refers to C, G, or T) was then annealed to the dT-tailed DNA by incubating at 94°C for 2 min, at 35°C for 2 min, and at 25°C, followed by extension reaction in a 50 μl reaction mixture containing 1 ng / μl tailed DNA, 0.5 mM dNTP, 1 unit of Klenow enzyme, and 5 units of Sequenase at 37°C for

PLoS Biology: New Articles 2009

RACE reactions were set up as follows: 5 µl of adapted cDNA, 0.2 µM 10×UPM primer, 0.2 µM gene-specific primer, 5 µl of 10×reaction buffer, 0.2 mM dNTP, 1 µl of BD Advantage 2

PLoS ONE Alerts: New Articles Zhihong Wu et al. 2009

Zhao X, Muller EG, Rothstein R (1998) A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools.

PLoS ONE Alerts: New Articles Xuefeng Chen et al. 2009